I would like to split a DNA sequence with a restriction enzyme.
A description enzyme can be describe as, e.g. r'(?<CA)(?=GCTG)'
I cannot get re.split to split on this pattern as perl 5 does.

Can you provide a sample DNA sequence (or part of it), the exact code you used, the output you got, and what you expected?

>>> re.split(r'(?<=CA)(?=GCTG)', 'CAGCTG')
['CAGCTG']

I think expected output is ['CA', 'GCTG'].

sorry if I wasn't clear.

s = 'ACGTCAGCTGAAACCCCAGCTGACGTACGT
re.split(r'(?<CA)(?=GCTG)',s)

expected output is:
acgtCA|GCTGaaacccCA|GCTGacgtacgt
-> ['ACGTCA', 'GCTGAAACCCCA', 'GCTGACGTACGT']

I would also be able to split a text on word boundaries:
re.split(r'\b', "the quick, brown fox")
-> ['the', ' ', 'quick', ', ', 'brown', ' ', 'fox']

but that doesn't work either so maybe it's a problem with all zero-width matches.

This looks as one of existing issue about zero-length matches (bpo-1647489, bpo-10328).

It is possible to change this behavior (see example patch). With this patch:

>>> re.split(r'(?<=CA)(?=GCTG)', 'ACGTCAGCTGAAACCCCAGCTGACGTACGT')
['ACGTCA', 'GCTGAAACCCCA', 'GCTGACGTACGT']
>>> re.split(r'\b', "the quick, brown fox")
['', 'the', ' ', 'quick', ', ', 'brown', ' ', 'fox', '']

But unfortunately this is backward incompatible change and will likely break existing code (and breaks tests). Consider following example: re.split('(:*)', 'ab'). Currently the result is ['ab'], but with the patch it is ['', '', 'a', '', 'b', '', ''].

In third-part regex module [1] there is the V1 flag which switches incompatible bahavior change.

>>> regex.split('(:*)', 'ab')
['ab']
>>> regex.split('(?V1)(:*)', 'ab')
['', '', 'a', '', 'b', '', '']
>>> regex.split(r'(?<=CA)(?=GCTG)', 'ACGTCAGCTGAAACCCCAGCTGACGTACGT')
['ACGTCAGCTGAAACCCCAGCTGACGTACGT']
>>> regex.split(r'(?V1)(?<=CA)(?=GCTG)', 'ACGTCAGCTGAAACCCCAGCTGACGTACGT')
['ACGTCA', 'GCTGAAACCCCA', 'GCTGACGTACGT']
>>> regex.split(r'\b', "the quick, brown fox")
['the quick, brown fox']
>>> regex.split(r'(?V1)\b', "the quick, brown fox")
['', 'the', ' ', 'quick', ', ', 'brown', ' ', 'fox', '']

I don't know how to solve this issue without introducing such flag (or adding special boolean argument to re.split()).

As a workaround I suggest you to use the regex module.

[1] https://pypi.python.org/pypi/regex

Previous attempts to solve this issue: bpo-852532, bpo-988761, bpo-3262.

re.split() with the r'(?<CA)(?=GCTG)' pattern raises a ValueError in 3.5 (see bpo-22818). In future releases it could be changed to work with zero-width patterns (such as lookaround assertions).