Issue1451466
Created on 2006-03-16 17:21 by richardchristen, last changed 2010-09-17 20:22 by amaury.forgeotdarc. This issue is now closed.
| Messages (10) | |||
|---|---|---|---|
| msg27792 - (view) | Author: christen (richardchristen) | Date: 2006-03-16 17:21 | |
I work on the human genome
I extracted words from chromosomes using a suffix tree
(C compiled for 64 done on a SUN with 300 Go RAM, since
my suffix tree requires 150 Go RAM for chromosome 1,
the largest one)
this gave some >5 Go files, for example with 163763326
lines for chr 4, the one presently analyzed.
Using python 2.4.2 on a windows 32-computer (1.5 Go
RAM), reading this file line by line either
for li in file:
do something
or
while li!='':
li=file.readline()
I got problems seemingly around the 4 Go boundary
(after reading the problematic first line), for some
lines (not all), the li returned the correct content
but with the first word of the next line also within li
(see below)
As a result a simple
file1=open('1')
file2=open('2','w')
li=file1.readline()
while li!='':
file2.write(li)
li=file1.readline()
produced a second file of only
163754385 lines
problem lines were "seemingly random", i.e. not in a
row, with the last line being OK.
The same code on the same file but on my OSX
64-dualcore machine went fine, despite the use of
default Python 2.2.3 and "file Python" showing it is a
Mach-0 executable ppc, i.e. a 32 bit app.
Everything was run from the command line.
the first file looks like that
...
TCAGCCACAGCAGAAAGTGA:\t33240 551212 751185
TCAGCCACAGCAGAAAGTGC:\t131324047
TCAGCCACAGCACTGTGTTA:\t61641912
....
the second file contains lines like these :
TCAGCCACAGCAGAAAGTGC:\t131324047TCAGCCACAGCAGAAGAAGA:
which is 'first line'+'1rst word of next line'
PS1 : no problem to read the big file with UEdit on the
windows machine. Therefore the OS itself is not the
problem (also I transfered the bigfile from the Windows
to the Mac, if the file had had problems, it would have
been corrupted on the Mac)
PS2 : I tried python 2.3.5 on windows with the same
problem.
PS3: If needed, I can run the same test on a similar
file but for chromosome 8 which is slightly below the 4
Go limit (3.99).
PS4: I think I remember having done a similar parsing
on a Linux Athlon 64 monoCPU a month ago, with no trouble.
|
|||
| msg27793 - (view) | Author: Josiah Carlson (josiahcarlson) | Date: 2006-03-18 00:35 | |
Logged In: YES user_id=341410 Sounds like an issue with file objects on certain platforms not being able to handle offsets of 2**32 or larger. I personally have read and written files > 4gb on the windows platform, but I seem to recall having issues on 32 bit linux some time in the past. |
|||
| msg27794 - (view) | Author: Tim Peters (tim_one) * ![]() |
Date: 2006-03-18 02:33 | |
Logged In: YES user_id=31435 "windows 32-computer" is too vague. Which operating system (Win95, Win98, WinME, NT, Win2K, WinXP), and which filesystem (FAT, FAT32, NTFS)? Are you sure this is a text file? If it's a binary file, then all sorts of bad things can happen opening it in text mode (which your sample code does). |
|||
| msg27795 - (view) | Author: christen (richardchristen) | Date: 2006-03-18 07:29 | |
Logged In: YES user_id=1477618 In reply to previous comment Are you sure this is a text file? Yes I made it myself. Besides I transfered it from the UX machine to the windows one by ftp with change of the end of line character to the window's kind. I checked with type myfile, that the control character was indeed changed. Also, I mentioned that I manually checked with Uedit, both in ASCII and HEX modes for the akward lines. "windows 32-computer" is too vague." I agree, I should have been more specific: System: Microsoft Windows 2000 Professionnel Version 5.0.2195 Service Pack 4 version 2195 Mother card : ASUSTek System Model A7N8X-E BIOS Phoenix AwardBIOS v6-00PG Memory 1.5Go Swap 2.4 Go File System NTFS Best Regards |
|||
| msg27796 - (view) | Author: christen (richardchristen) | Date: 2007-07-02 07:11 | |
In 2006, I signaled a bug in windows 32 for reading very large files : python-Bugs-1451466
I have now tried with a windows 64 machines and python 2.5
I find the same bug
For very large files (the two I tried were around 7-8 Go), the end of line is sometimes not taken into account
The file is fine, as viewed in hexa, the end of line characters are perfectly ok at the place where the parser goes wrong.
Everything seems to be ok with the same script on my Mac OSX
Exemple :
Original file reads:
###########################
.........
Query= 10|ENSG00000203288|pseudogene|105829416|105829650|-
1|ENSE00001440927|105829519|105829650|-1|1
(132 letters)
Database: Homo_sapiens.NCBI36.45.dna.chromosome17
1 sequences; 78,774,742 total letters
...............
###########################
in hexa:
###########################
...
c5bd3500h: 32 2E 0D 0A 0D 0A 51 75 65 72 79 3D 20 31 30 7C ; 2.....Query= 10|
c5bd3510h: 45 4E 53 47 30 30 30 30 30 32 30 33 32 38 38 7C ; ENSG00000203288|
c5bd3520h: 70 73 65 75 64 6F 67 65 6E 65 7C 31 30 35 38 32 ; pseudogene|10582
c5bd3530h: 39 34 31 36 7C 31 30 35 38 32 39 36 35 30 7C 2D ; 9416|105829650|-
c5bd3540h: 0D 0A 31 7C 45 4E 53 45 30 30 30 30 31 34 34 30 ; ..1|ENSE00001440
c5bd3550h: 39 32 37 7C 31 30 35 38 32 39 35 31 39 7C 31 30 ; 927|105829519|10
c5bd3560h: 35 38 32 39 36 35 30 7C 2D 31 7C 31 0D 0A 20 20 ; 5829650|-1|1..
c5bd3570h: 20 20 20 20 20 20 20 28 31 33 32 20 6C 65 74 74 ; (132 lett
c5bd3580h: 65 72 73 29 0D 0A 0D 0A 44 61 74 61 62 61 73 65 ; ers)....Database
c5bd3590h: 3A 20 48 6F 6D 6F 5F 73 61 70 69 65 6E 73 2E 4E ; : Homo_sapiens.N
c5bd35a0h: 43 42 49 33 36 2E 34 35 2E 64 6E 61 2E 63 68 72 ; CBI36.45.dna.chr
c5bd35b0h: 6F 6D 6F 73 6F 6D 65 31 37 20 0D 0A 20 20 20 20 ; omosome17 ..
c5bd35c0h: 20 20 20 20 20 20 20 31 20 73 65 71 75 65 6E 63 ; 1 sequenc
c5bd35d0h: 65 73 3B 20 37 38 2C 37 37 34 2C 37 34 32 20 74 ; es; 78,774,742 t
c5bd35e0h: 6F 74 61 6C 20 6C 65 74 74 65 72 73 0D 0A 0D 0A ; otal letters....
...
#######################################
Demo: python script :
#############################
import os.path
initial_dir=r'D:\human_exons\chr17'
fichier=os.path.join(initial_dir, '10_17.out')
fichin=open(fichier)
ok=0
i=0
for li in fichin:
i+=1
if li.startswith('Query= '):
query=li
elif li.startswith('1|ENSE00001440927|105829519|105829650|-1|1'):
ok=1
if ok==1:
print i
print query
print li
fichin.close()
################################
output :
160968087
Query= 10|ENSG00000203288|pseudogene|105829416|105829650|-
1|ENSE00001440927|105829519|105829650|-1|1 (132 letters)
160968088
Query= 10|ENSG00000203288|pseudogene|105829416|105829650|-
in fact line 160968087, should be 160981763
####################################
Computer
Dell Precision PWS690 2 CPU dual core
Intel Xeon
5160 @ 3.00GHz
2.99 GHz, 16.0 GB of RAM
Microsoft Windows XP
Professional x64 Edition
Version 2003
Windows [Version 5.2.3790]
#####################################
Richard Christen
|
|||
| msg63154 - (view) | Author: Joseph Armbruster (JosephArmbruster) | Date: 2008-03-01 01:04 | |
I believe this may be related to issue 1672853. http://bugs.python.org/issue1672853 |
|||
| msg63441 - (view) | Author: Joseph Armbruster (JosephArmbruster) | Date: 2008-03-10 13:00 | |
Note: If this issue is related to 1672853, I ran through the test code provided in the issue recently and it appeared to pass for both the trunk and 2.5 maint. |
|||
| msg105542 - (view) | Author: Terry J. Reedy (terry.reedy) * ![]() |
Date: 2010-05-11 20:49 | |
Is this still an issue for 2.7? |
|||
| msg105583 - (view) | Author: christen (Richard.Christen@unice.fr) | Date: 2010-05-12 12:30 | |
I have no idea because - I am using 2.5 (windows) or 2.6 (2.5 because of old stuff that I compiled compatible with 2.5 not 2.6) - I am using open(file, 'U') that solved the problem under windows, and the pd does not exist in Linux best Richard Terry J. Reedy a écrit : > Terry J. Reedy <tjreedy@udel.edu> added the comment: > > Is this still an issue for 2.7? > > ---------- > nosy: +tjreedy > > _______________________________________ > Python tracker <report@bugs.python.org> > <http://bugs.python.org/issue1451466> > _______________________________________ > > > |
|||
| msg116719 - (view) | Author: Amaury Forgeot d'Arc (amaury.forgeotdarc) * ![]() |
Date: 2010-09-17 20:22 | |
issue1744752 describes why it's probably a bug in the C library. possible workarounds are to open the files in universal mode, to use io.open(), or to switch to python 3! |
|||
| History | |||
|---|---|---|---|
| Date | User | Action | Args |
| 2010-09-17 20:22:25 | amaury.forgeotdarc | set | status: open -> closed nosy: + amaury.forgeotdarc messages: + msg116719 superseder: Newline skipped in "for line in file" for huge file resolution: wont fix |
| 2010-05-12 12:30:50 | Richard.Christen@unice.fr | set | nosy:
+ Richard.Christen@unice.fr messages: + msg105583 |
| 2010-05-11 20:49:45 | terry.reedy | set | nosy:
+ terry.reedy messages: + msg105542 |
| 2009-03-30 06:32:45 | ajaksu2 | set | dependencies:
+ Error reading files larger than 4GB type: behavior stage: test needed versions: + Python 2.6, - Python 2.5 |
| 2008-03-10 13:00:50 | JosephArmbruster | set | messages: + msg63441 |
| 2008-03-01 01:04:08 | JosephArmbruster | set | nosy:
+ JosephArmbruster messages: + msg63154 |
| 2006-03-16 17:21:35 | richardchristen | create | |
